Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (closed)) - Couverture souple
Synopsis
Using the latest techniques of molecular genetics it is now possible to study the mechanisms of cell growth and differentiation at the molecular level. Especially the application of viral vectors to visualize and analyze gene expression, the techniques of stem cell manipulation as well as various results regarding the function of oncogenes or the role of cytokines and growth factors are discussed leading to new interpretations of the mechanisms which lead to normal or abnormal cell differentiation.
Les informations fournies dans la section « Synopsis » peuvent faire référence à une autre édition de ce titre.
Autres éditions populaires du même titre
Résultats de recherche pour Vectors as Tools for the Study of Normal and Abnormal...
Image d'archives
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato ASI Subseries H:, 34)
Vendeur : Ria Christie Collections, Uxbridge, Royaume-Uni
Évaluation du vendeur 5 sur 5 étoiles
Etat : New. In. N° de réf. du vendeur ria9783642741999_new
Acheter neuf
EUR 110,73
Expédition à EUR 13,66
Expédition depuis Royaume-Uni vers Etats-Unis
Expédition depuis Royaume-Uni vers Etats-Unis
Quantité disponible : Plus de 20 disponibles
Image d'archives
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (closed)) (Nato ASI Subseries H:)
Vendeur : California Books, Miami, FL, Etats-Unis
Évaluation du vendeur 5 sur 5 étoiles
Etat : New. N° de réf. du vendeur I-9783642741999
Acheter neuf
EUR 126,13
Livraison gratuite
Expédition nationale : Etats-Unis
Expédition nationale : Etats-Unis
Quantité disponible : Plus de 20 disponibles
Image fournie par le vendeur
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Edité par
Springer Berlin Heidelberg, 2011
ISBN 10 : 3642741991
ISBN 13 : 9783642741999
Neuf
Couverture souple
Vendeur : moluna, Greven, Allemagne
Évaluation du vendeur 4 sur 5 étoiles
Etat : New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an. N° de réf. du vendeur 5069486
Acheter neuf
EUR 118,64
Expédition à EUR 48,99
Expédition depuis Allemagne vers Etats-Unis
Expédition depuis Allemagne vers Etats-Unis
Quantité disponible : Plus de 20 disponibles
Image d'archives
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato Asi Series (Closed) / Nato Asi Subseries H: (Closed))
Vendeur : Revaluation Books, Exeter, Royaume-Uni
Évaluation du vendeur 5 sur 5 étoiles
Paperback. Etat : Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock. N° de réf. du vendeur x-3642741991
Acheter neuf
EUR 154,62
Expédition à EUR 14,25
Expédition depuis Royaume-Uni vers Etats-Unis
Expédition depuis Royaume-Uni vers Etats-Unis
Quantité disponible : 2 disponible(s)
Image fournie par le vendeur
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Edité par
Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10 : 3642741991
ISBN 13 : 9783642741999
Neuf
Taschenbuch
Vendeur : AHA-BUCH GmbH, Einbeck, Allemagne
Évaluation du vendeur 5 sur 5 étoiles
Taschenbuch. Etat : Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . . N° de réf. du vendeur 9783642741999
Acheter neuf
EUR 146,51
Expédition à EUR 64,17
Expédition depuis Allemagne vers Etats-Unis
Expédition depuis Allemagne vers Etats-Unis
Quantité disponible : 2 disponible(s)