Vectors tools study normal (13 résultats)
Langue : anglais
Edité par Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
- Couverture rigide
Vendeur : Ammareal, Morangis, FranceAmmareal
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Occasion - Très bon
EUR 5,57
EUR 16,50 expéditionExpédition depuis France vers Etats-UnisQuantité disponible : 1 disponible(s)
Hardcover. Etat : Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
- Couverture souple
Vendeur : Ria Christie Collections, Uxbridge, Royaume-UniRia Christie Collections
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Neuf
EUR 116,63
EUR 14,00 expéditionExpédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : Plus de 20 disponibles
Etat : New. In.
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
NATO Advanced Research Workshop On "Vectors For Transfer And Expression Of Genes" (1988 : Wilsede, Germany); Dernick, Rudolf; Lother, Heinz; Heinrich-Pette-Institut Fur Experimentelle Virologie Und Immunologie; North Atlantic Treaty Organization. Scientific Affairs Division
- Couverture souple
Vendeur : Romtrade Corp., STERLING HEIGHTS, MI, Etats-UnisRomtrade Corp.
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Neuf
EUR 131,00
Frais de port gratuitsExpédition nationale : Etats-UnisQuantité disponible : 1 disponible(s)
Etat : New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.
- Couverture souple
Vendeur : Basi6 International, Irving, TX, Etats-UnisBasi6 International
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Neuf
EUR 131,42
Frais de port gratuitsExpédition nationale : Etats-UnisQuantité disponible : 1 disponible(s)
Etat : Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.
- Couverture souple
Vendeur : Books Puddle, New York, NY, Etats-UnisBooks Puddle
Contacter le vendeurVendeur avec une évaluation de 4 étoilesEtat: Neuf
EUR 147,29
EUR 3,42 expéditionExpédition nationale : Etats-UnisQuantité disponible : 4 disponible(s)
Etat : New. pp. viii + 477.
- Couverture souple
Vendeur : Books Puddle, New York, NY, Etats-UnisBooks Puddle
Contacter le vendeurVendeur avec une évaluation de 4 étoilesEtat: Occasion
EUR 156,58
EUR 3,42 expéditionExpédition nationale : Etats-UnisQuantité disponible : 1 disponible(s)
Etat : Used. pp. 475 1st Edition.
- Couverture souple
Vendeur : Majestic Books, Hounslow, Royaume-UniMajestic Books
Contacter le vendeurVendeur avec une évaluation de 4 étoilesEtat: Occasion
EUR 162,17
EUR 7,60 expéditionExpédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : 1 disponible(s)
Etat : Used. pp. 475.
- Couverture souple
Vendeur : Revaluation Books, Exeter, Royaume-UniRevaluation Books
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Neuf
EUR 156,34
EUR 14,61 expéditionExpédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : 2 disponible(s)
Paperback. Etat : Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
- Couverture souple
Vendeur : moluna, Greven, Allemagnemoluna
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Neuf
EUR 118,64
EUR 48,99 expéditionExpédition depuis Allemagne vers Etats-UnisQuantité disponible : Plus de 20 disponibles
Etat : New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
- Couverture souple
Vendeur : Biblios, frankfurt am main, HESSE, AllemagneBiblios
Contacter le vendeurVendeur avec une évaluation de 4 étoilesEtat: Occasion
EUR 167,73
EUR 9,95 expéditionExpédition depuis Allemagne vers Etats-UnisQuantité disponible : 1 disponible(s)
Etat : Used. pp. 475.
Langue : anglais
Edité par Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
- Couverture souple
Vendeur : AHA-BUCH GmbH, Einbeck, AllemagneAHA-BUCH GmbH
Contacter le vendeurVendeur avec une évaluation de 5 étoilesEtat: Neuf
EUR 146,51
EUR 64,17 expéditionExpédition depuis Allemagne vers Etats-UnisQuantité disponible : 2 disponible(s)
Taschenbuch. Etat : Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is trig…gered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .
- Couverture souple
- impression à la demande
Vendeur : Majestic Books, Hounslow, Royaume-UniMajestic Books
Contacter le vendeurVendeur avec une évaluation de 4 étoilesEtat: Neuf
EUR 151,02
EUR 7,60 expéditionExpédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : 4 disponible(s)
Etat : New. Print on Demand pp. viii + 477 100 Figures.
- Couverture souple
- impression à la demande
Vendeur : Biblios, frankfurt am main, HESSE, AllemagneBiblios
Contacter le vendeurVendeur avec une évaluation de 4 étoilesEtat: Neuf
EUR 154,68
EUR 9,95 expéditionExpédition depuis Allemagne vers Etats-UnisQuantité disponible : 4 disponible(s)
Etat : New. PRINT ON DEMAND pp. viii + 477.
