Montant total (1 article articles) :
Destination de la commande :
vectors tools study normal (14 résultats)
Passer aux résultats principaux de la recherche
Filtres de recherche
Type d'article
- Tous les types de produits
- Livres (14)
- Magazines & Périodiques (Aucun autre résultat ne correspond à ces critères)
- Bandes dessinées (Aucun autre résultat ne correspond à ces critères)
- Partitions de musique (Aucun autre résultat ne correspond à ces critères)
- Art, Affiches et Gravures (Aucun autre résultat ne correspond à ces critères)
- Photographies (Aucun autre résultat ne correspond à ces critères)
- Cartes (Aucun autre résultat ne correspond à ces critères)
- Manuscrits & Papiers anciens (Aucun autre résultat ne correspond à ces critères)
Etat En savoir plus
- Neuf (9)
- Comme neuf, Très bon ou Bon (1)
- Assez bon ou satisfaisant (Aucun autre résultat ne correspond à ces critères)
- Moyen ou mauvais (Aucun autre résultat ne correspond à ces critères)
- Conformément à la description (4)
Particularités
- Ed. originale (Aucun autre résultat ne correspond à ces critères)
- Signé (Aucun autre résultat ne correspond à ces critères)
- Jaquette (Aucun autre résultat ne correspond à ces critères)
- Avec images (3)
- Sans impressions à la demande (12)
Langue (1)
Livraison gratuite
Pays
Evaluation du vendeur
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Langue: anglais
Edité par Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
ISBN 10 : 3540504192 ISBN 13 : 9783540504191
Bonne affaireEUR 5,01
Expédition à EUR 16,50
Expédition depuis France vers Etats-UnisQuantité disponible : 1 disponible(s)
Ajouter au panierHardcover. Etat : Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato ASI Subseries H:, 34)
Vendeur : Ria Christie Collections, Uxbridge, Royaume-Uni
Évaluation du vendeur 5 sur 5 étoiles
EUR 113,71
Expédition à EUR 13,76
Expédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : Plus de 20 disponibles
Ajouter au panierEtat : New. In.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Basi6 International, Irving, TX, Etats-Unis
Évaluation du vendeur 5 sur 5 étoiles
EUR 133,93
Livraison gratuite
Expédition nationale : Etats-UnisQuantité disponible : 1 disponible(s)
Ajouter au panierEtat : Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Romtrade Corp., STERLING HEIGHTS, MI, Etats-Unis
Évaluation du vendeur 5 sur 5 étoiles
EUR 134,29
Livraison gratuite
Expédition nationale : Etats-UnisQuantité disponible : 1 disponible(s)
Ajouter au panierEtat : New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.
-
![Image du vendeur pour Vectors as tools for the study of normal and abnormal growth and differentiation : [proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21 - 24, 1988 on the occasion of the 40th anniversary of the Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg (HPI)]. ed. by H. Lother . Publ. in coop. with NATO Scientif. Affairs Div. / NATO: NATO ASI series / Series H, Cell biology ; Vol. 34 mis en vente par Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein](https://pictures.abebooks.com/inventory/md/md30732786818.jpg)
Vectors as tools for the study of normal and abnormal growth and differentiation : [proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21 - 24, 1988 on the occasion of the 40th anniversary of the Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg (HPI)]. ed. by H. Lother . Publ. in coop. with NATO Scientif. Affairs Div. / NATO: NATO ASI series / Series H, Cell biology ; Vol. 34
Langue: anglais
Edité par Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer,, 1989
ISBN 10 : 3540504192 ISBN 13 : 9783540504191
Vendeur : Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, Allemagne
Évaluation du vendeur 5 sur 5 étoiles
EUR 99
Expédition à EUR 39
Expédition depuis Allemagne vers Etats-UnisQuantité disponible : 2 disponible(s)
Ajouter au paniergr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Books Puddle, New York, NY, Etats-Unis
Évaluation du vendeur 4 sur 5 étoiles
EUR 149,14
Expédition à EUR 3,42
Expédition nationale : Etats-UnisQuantité disponible : 4 disponible(s)
Ajouter au panierEtat : New. pp. viii + 477.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Books Puddle, New York, NY, Etats-Unis
Évaluation du vendeur 4 sur 5 étoiles
EUR 156,17
Expédition à EUR 3,42
Expédition nationale : Etats-UnisQuantité disponible : 1 disponible(s)
Ajouter au panierEtat : Used. pp. 475 1st Edition.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato Asi Series (Closed) / Nato Asi Subseries H: (Closed))
Vendeur : Revaluation Books, Exeter, Royaume-Uni
Évaluation du vendeur 5 sur 5 étoiles
EUR 155,26
Expédition à EUR 14,35
Expédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : 2 disponible(s)
Ajouter au panierPaperback. Etat : Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Langue: anglais
Edité par Springer Berlin Heidelberg, 2011
ISBN 10 : 3642741991 ISBN 13 : 9783642741999
EUR 118,64
Expédition à EUR 48,99
Expédition depuis Allemagne vers Etats-UnisQuantité disponible : Plus de 20 disponibles
Ajouter au panierEtat : New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Biblios, Frankfurt am main, HESSE, Allemagne
Évaluation du vendeur 4 sur 5 étoiles
EUR 162,61
Expédition à EUR 9,95
Expédition depuis Allemagne vers Etats-UnisQuantité disponible : 1 disponible(s)
Ajouter au panierEtat : Used. pp. 475.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Majestic Books, Hounslow, Royaume-Uni
Évaluation du vendeur 4 sur 5 étoiles
EUR 175,89
Expédition à EUR 7,46
Expédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : 1 disponible(s)
Ajouter au panierEtat : Used. pp. 475.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Langue: anglais
Edité par Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10 : 3642741991 ISBN 13 : 9783642741999
Vendeur : AHA-BUCH GmbH, Einbeck, Allemagne
Évaluation du vendeur 5 sur 5 étoiles
EUR 146,51
Expédition à EUR 64,17
Expédition depuis Allemagne vers Etats-UnisQuantité disponible : 2 disponible(s)
Ajouter au panierTaschenbuch. Etat : Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Majestic Books, Hounslow, Royaume-Uni
Évaluation du vendeur 4 sur 5 étoiles
EUR 151,38
Expédition à EUR 7,46
Expédition depuis Royaume-Uni vers Etats-UnisQuantité disponible : 4 disponible(s)
Ajouter au panierEtat : New. Print on Demand pp. viii + 477 100 Figures.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Vendeur : Biblios, Frankfurt am main, HESSE, Allemagne
Évaluation du vendeur 4 sur 5 étoiles
EUR 152,32
Expédition à EUR 9,95
Expédition depuis Allemagne vers Etats-UnisQuantité disponible : 4 disponible(s)
Ajouter au panierEtat : New. PRINT ON DEMAND pp. viii + 477.
